OriGene Technologies, Inc.
Search:    
About FL cDNA Clones RNAi Gene Expression Lysates and Proteins Antibodies Tissue Other Products Tech Support
orange


Over 1000 citations of OriGene cDNA clones
Bat3 promotes the membrane integration of tail-anchored proteins J. Cell Sci., Jul 2010; 123: 2170 - 2178 [BAT3]
Caveolin-1 modulates HIV-1 envelope induced bystander apoptosis through gp41 J. Virol., Jul 2010; 84: 6515 - 6526 [CAV1]
Chronic lymphocytic leukemia modeled in mouse by targeted miR-29 expression PNAS, Jul 2010; 107: 12210 - 12215 [PXDN]
HIV infection upregulates Caveolin 1 (Cav-1) expression to restrict virus production J. Virol., Jul 2010; 10.1128/JVI.00763-10. [CAV1]
View All Citations >>

 

Custom Request form for Clone Modification

divider

* OriGene Clone To Be Modified: Please enter OriGene Catalog Number only, e.g. RC200003
Modification Needed
Example #1: Mutate nucleotide position 359 G to T, resulting in an alanine into threonine substitution in codon 87 (A87T). Subclone the mutated insert into PS100019 for N-teminus GFP tagging.

Example #2: Subclone the indicated sequence from the parental clone into PS100031 vector for domain expression. ATGGTGGCCCGGTTAAGGGCTCGGTAGCTCTGTAGCTGGAGCTGAG
* Plasmid Needed (µg)
spacer
* First Name
* Last Name
* Email Address
* Institution Name
* Country
* Phone
    
* is required field
bar
Copyright © 2010 OriGene Technologies, Inc. All Rights Reserved. Legal Notices.
9620 Medical Center Dr., Suite 200, Rockville, MD 20850 • 1.888.267.4436


Reproduction of any materials from this website is strictly forbidden without permission.